You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.
 
Samy Delahaye b1d976e7a0 Adding docs folder 1 year ago
docs Adding docs folder 1 year ago
tests Signature 1 year ago
.gitignore Adding docs folder 1 year ago
README.md Initial commit of README.md 1 year ago

README.md

DNA

Le but de ce projet est de transformer un fichier csv d'entrée en un fichier csv de sortie dont le format (délimiteur, ordre des colonnes, etc.) est différent de celui d'entrée.

Objectif

Notre script devra recevoir en paramètre le chemin vers le fichier csv et produire un fichier csv en sortie contenant les informations du fichier d'entrée au nouveau format, voici un exemple de l'appel de ce script:

$ transform.py /home/nedry/dna.csv

Exemple d'entrée/sortie attendu

CSV IN

col1~col2
Dilophosaurus~tcgtgtcaaatagggcttcc
Velociraptor~tagtggaccaattactggac
Brachiosaurus~tcgctatccacccaacccgg
Parasaurolophus~atgcactatcactatcgttc
Triceratops~gtgatattatgccctcgcga
Tyrannosaurus Rex~cgctacggagaccggccttg
Gallimimus~catgccatctggagagtttc

CSV OUT

dna;name
TCGTGTCAAATAGGGCTTCC;Dilophosaurus
TAGTGGACCAATTACTGGAC;Velociraptor
TCGCTATCCACCCAACCCGG;Brachiosaurus
ATGCACTATCACTATCGTTC;Parasaurolophus
GTGATATTATGCCCTCGCGA;Triceratops
CGCTACGGAGACCGGCCTTG;Tyrannosaurus Rex
CATGCCATCTGGAGAGTTTC;Gallimimus

Diagramme de cas d'utilisation

center

Diagramme d'activité

center

Le projet

Pour lancer les tests unitaires (en se plaçant à la racine du projet):

$ python3 -m unittest

Pour créer la documentation du projet:

$ ./makedocs.sh

Pour lancer le projet:

python3 transform.py /home/nedry/dna.csv